Harper BIO101 Mutations Homework Latest 2020 MAY
BIO101 Biology Survey
Mutations Homework
Protein Structure:
There are four levels of protein folding: primary, secondary, tertiary, and quaternary. The four levels are represented in the diagram to the right. To what level of folding does each of the following correspond?
|
Primary Structure: |
|
Secondary Structure: |
|
Tertiary Structure: |
|
Quaternary Structure: |
Tertiary structure
Primary structure B.
Secondary structureC.
Quaternary structureD.
Secondary structure E.
Quaternary structureF.
Primary structureG.
Secondary structureH.
Tertiary structureI.
1. What is a genetic mutation?
2. During what process do most DNA mutations occur?
3. Define the following types of mutations:
A. Base Substitution:
B. Deletion:
C. Frameshift:
D. Insertion:
4. Define the following types of point mutations.
A. Silent:
B. Nonsense:
C. Missense:
5. EXPLAIN how a mutation in DNA can lead to a nonfunctional protein. Include the importance of structure in your answer.
6.Gene Expression Problem - Use the Genetic Code Table to complete the following exercise.
A. The following DNA sequence is part of a gene that codes for an enzyme (protein) involved in glycolysis. Transcribe this DNA sequence into an mRNA sequence.
CCGTACAATGTACCCGGGACTATTTTACT
B. Think about where translation starts and stops. Use the genetic code to translate the mRNA molecule you transcribed above into an amino acid sequence.
C. A point mutation occurs in the DNA that causes the third codon in the mRNA to change from CAU to CGU. What type of mutation is this? (silent, missense, frameshift, or nonsense)
D. A point mutation occurs in the DNA that causes the fifth codon in the mRNA to change from CCC to CCA. What type of mutation is this? (silent, missense, frameshift, or nonsense)
E. A point mutation occurs in the DNA that causes the second codon in the mRNA to change from UUA to UAA. What type of mutation is this? (silent, missense, frameshift, or nonsense)
F. A deletion in the DNA results in the removal of two nucleotides in the mRNA. The resulting mRNA is below. The bases were removed at the ’
GGCAUGU’CAUGGGCCCUGAUAAAAUGA
What is the resulting amino acid sequence?
What type of mutation is this?
-
Rating:
/5
Solution: Harper BIO101 Mutations Homework Latest 2020 MAY