Assignment 3 - DNA, is always interpreted using the same code

Assignment 3

This assignment is marked out of 100 possible points and is worth 15 % of your final grade. It is based on Units 9–13. Complete it after Unit 13. Submit it to your academic expert for grading using the appropriate Assignment Drop Box.

Unless otherwise directed, the information you need to answer these questions is available from the course materials. Further research is not required. Some questions may require information from more than one unit or lesson.

Answer the questions in your own words, using full sentences unless directed to do otherwise.

For each of questions 1–5, select and support the most appropriate response, and explain why each of the incorrect statements is eliminated.

1. DNA

a. is always interpreted using the same code, with minor exceptions.

b. incorporates any type of the five nitrogenous bases.

c. bases occur in random order.

d. joins bases to each other covalently.

e. is not the genetic material in bacteria. (5 marks)

2. Which of these factors does not influence the rate of mutation?

a. the presence of a repetitive sequence

b. the protein encoded by the gene

c. the presence of a palindrome

d. a gene’s length

e. the ability to repair DNA (5 marks)

3. Eugenics

a. depends on voluntary participation.

b. is successful at eliminating harmful recessive alleles from a population.

c. is a form of natural selection.

d. is intended to alleviate individual suffering.

e. may involve sterilization. (5 marks)

4. Analysis of which source of data does not contribute to tracing human and/or ancestral human migration patterns?

a. fossils

b. mitochondrial DNA

c. admixture info

d. chromosome banding

e. haplogroups (5 marks)

Biology 341: Human Genetics (Rev. C14) 1

5. Compare the contributions of Levene and Chargaff in the determination of the structure of DNA. Why wasn’t their information enough to determine the correct structure?

(4 marks)

6. Repeat the exercise described in Unit 9 Lesson 3 Study Question 2 for a third replication (do

not submit this drawing). How many double helices will contain only higher-density

nitrogen? How many double helices will have intermediate density? How many double

helices will contain only lighter-density nitrogen? (3 marks)

7. Compare cellular DNA replication to PCR replication. (6 marks)

8. The following sequence is a DNA coding strand representing a portion of a gene.

(9 marks)

5’…ATGCGTTCAGCTACTTTAGAGCGAATCC… 3’

a. Give the sequence that will be produced in replication.

b. What sequence will be produced as a result of transcription?

c. Translate the sequence in part b, using three reading frames. Do not translate the partial codons.

d. What feature of the genetic code is revealed by these sequences? Identify a specific example.

9. There are 49 nuclear genes that code for tRNA molecules. There are 61 codons for amino

acids. The 49 different tRNA molecules can translate all 61 amino acid codons. Answer the following theoretical questions, and explain your answers. Include the names of the amino acids for the codons noted. (6 marks)

a. Could a single type of tRNA molecule be used in the translation of CAC and CAG?

b. Could a single type of tRNA molecule be used to translate AUU and AUA?

c. Could a single type of tRNA molecule be used to translate UCU and AGC?

10. Do these descriptions support or refute the statement that a region of DNA can code for more than one polypeptide? Explain. (6 marks)

a. Exons can be joined in different combinations.

b. An intron can become an exon.

c. Both strands of the DNA can be used as different genes.

11. Compare and contrast genetic heterogeneity and allelic disorders. (4 marks)

12. Describe the possible effects of each of these mutations on a gene’s protein. Which of these mutations in a gene would likely have the most severe effect on its protein? Explain.

a. missense

b. point mutation in an intron

c. a deletion of three bases

d. a translocation

e. a nonsense mutation at the end of the gene (12 marks)

Biology 341: Human Genetics (Rev. C14) 2